RNAi Lines - D to M - Bloomington Drosophila Stock Center

VALIUM21 and VALIUM22 - UAS-Dicer2 not needed as they use shRNAs; both contain a P transposase basal promoter and a K10 polyA for germline ...

Knockdown vectors | DRSC/TRiP Functional Genomics Resources ...

VALIUM22 features the P-transposase core promoter; a multiple cloning site (MCS) for cloning shRNAs in a miR1 scaffold, and a ftz 3'UTR intron followed by a ...

Custom Result

This is a custom result inserted after the second result.

TRiP RNAi fly stocks

2nd generation stocks made in the VALIUM20 and VALIUM22 vectors (also VALIUM21 - a variant of VALIUM22). VALIUM20 is effective in both the soma and germline.

The Transgenic RNAi Project at Harvard Medical School - NCBI

shRNAs (21 bp) were cloned into VALIUM series vectors (VALIUM20, VALIUM21, or VALIUM22) and injected into embryos for targeted phiC31 ...

Simple Stock Search - Bloomington Drosophila Stock Center

Expresses dsRNA for RNAi of Mad (FBgn0011648) under UAS control in the VALIUM22 vector. Map: Chr 2, 25C6, 2L:5108448. Reference: Perkins et al., 2015 ...

Transgenic RNAi & Transcriptional activation (FlySAM)

VALIUM22, attp2,on 3rd chromosome,or attp40,on 2nd chromosome, works significantly in female germline; do not work well in soma, Ni et al., 2011, Nature ...

A genome-scale shRNA resource for transgenic RNAi in Drosophila

We chose the ovarian Piwi-interacting RNA (piRNA) pathway as a system to compare the efficacies and specificities of Valium20 and Valium22.

[PDF] valium22

Page 1. Page 2. VALIUM22: 8973bp p. 1. CACCTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTT.

The Transgenic RNAi Resource Project

Second Generation Hairpins - short hairpin RNA in VALIUM20 and VALIUM22 (and VALIUM21). REAGENTS, MAPS & PROTOCOLS. Knockdown Vectors: · pVALIUM1 · pVALIUM10 ...