VALIUM21 and VALIUM22 - UAS-Dicer2 not needed as they use shRNAs; both contain a P transposase basal promoter and a K10 polyA for germline ...
VALIUM22 features the P-transposase core promoter; a multiple cloning site (MCS) for cloning shRNAs in a miR1 scaffold, and a ftz 3'UTR intron followed by a ...
This is a custom result inserted after the second result.
2nd generation stocks made in the VALIUM20 and VALIUM22 vectors (also VALIUM21 - a variant of VALIUM22). VALIUM20 is effective in both the soma and germline.
shRNAs (21 bp) were cloned into VALIUM series vectors (VALIUM20, VALIUM21, or VALIUM22) and injected into embryos for targeted phiC31 ...
Expresses dsRNA for RNAi of Mad (FBgn0011648) under UAS control in the VALIUM22 vector. Map: Chr 2, 25C6, 2L:5108448. Reference: Perkins et al., 2015 ...
VALIUM22, attp2,on 3rd chromosome,or attp40,on 2nd chromosome, works significantly in female germline; do not work well in soma, Ni et al., 2011, Nature ...
We chose the ovarian Piwi-interacting RNA (piRNA) pathway as a system to compare the efficacies and specificities of Valium20 and Valium22.
Page 1. Page 2. VALIUM22: 8973bp p. 1. CACCTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTT.
Second Generation Hairpins - short hairpin RNA in VALIUM20 and VALIUM22 (and VALIUM21). REAGENTS, MAPS & PROTOCOLS. Knockdown Vectors: · pVALIUM1 · pVALIUM10 ...